-
As of today ICMag has his own Discord server. In this Discord server you can chat, talk with eachother, listen to music, share stories and pictures...and much more. Join now and let's grow together! Join ICMag Discord here! More details in this thread here: here.
BOG Seeds Sour Bubble.
- Thread starter southwind
- Start date
MrKushman247
Well-known member
Fwiw Silverback (rip) told me straight up bubblegum was bred by his family circle and bikers from Oakland. Mexican they had crossed with Afghani the bikers had and they bred it in cornfields of Indiana. He gave me beans but I couldn't get them to sprout unfortunately. I had no reason not to believe him. He was a real OG.
acespicoli
Well-known member
I think the NL/Bubba is a huge element in the structure the leaf resin has to be over whelming
A true hashplant in the details that crust on dark wide leaves, this looks like the large fan leaves have been removed perhaps you think? Got a touch of that TH DC affie look to me, wonder if the bud could be bulked without losing the frost
CannaT
starin' at the world through my rearview
It was you
But anyway breeder said no Bubba kush...so only WL bubblegum probably WL bubblegum is Bubblegumclone only x NL1 it was fruities and most indica of all NL.
So that is that connection with Bubba kush ?
acespicoli
Well-known member
Yeah @Hammerhead is doing the proper homework for the conservation of the pheno type most desirable, he has some frosty plants in the stable already. Cant wait to see what he comes thru with.View attachment 18812388
View attachment 18812389
View attachment 18812390
View attachment 18812391
Good selection makes wonders.
locking down those resin traits in the bx's is the work that has to be done, bubble bags full of resin
In your screenshots and his last post good examples of the goal, those concentrates are the medicine.
Borrowed some pics for reference
Those pictures of SourBubble kief and hash
hope some others share hash shots!Attachments
Last edited:
You’re taking his post completely out of context. He was saying YOUR description of a THSeeds “Bubblegum” (the quote marks are because it’s not pure Bubblegum in the first place) reminds him of GG4xGelato, NOT Sour Bubble! He was saying your description does NOT sound like Sour Bubble.View attachment 18812392
It was you
But anyway breeder said no Bubba kush...so only WL bubblegum probably WL bubblegum is Bubblegumclone only x NL1 it was fruities and most indica of all NL.
So that is that connection with Bubba kush ?
You need to go back and have a VERY good look at the data supplied by Beta from Phylos. You can see the link between Sour Bubble and American Kush genetics!!
End of - you have absolutely no basis for your argument whatsoever. Just because a plant ‘looks’ a little bit like another plant means absolutely nothing.
You also seem to miss the posts where everybody concerned is talking about early SB, not the later releases of SB which you continually refer to. Your plant looks nothing like early releases of Sour Bubble.
Last edited:
Also @CannaT please please stop referring to seedfinder. It’s well known that the information on that website in some cases is rarely correct. It is not a moderated website. It has been pointed out on more than one occasion, by people who know, that there was definitely other genetics involved with the Sour Bubble. It was practically admitted by Bog himself to a chosen few.
acespicoli
Well-known member
Phylos and Seedfinder... Very good ideas
https://en.seedfinder.eu/userarea/login.html become a member like me and make it better edit mistakes
We need a opensource public genetic testing facility and database
Also looking into resources like this https://en.wikipedia.org/wiki/Comparison_of_genealogy_software
Plant pictures and breeding charts with DNA, many hobby breeders are likely not keeping great records
Anyone using other softs or methods? Maybe with this strain here we can do better.
FOR EXAMPLE
Cannatonic strain as a reference (GenBank MNPR01)
This type of data below wont be useful to most of us
>MNPR01000001.1 Cannabis sativa cultivar Cannatonic Cannabis.v1_scf1_q, whole genome shotgun sequence
GTGACAAGAGTAACCCTAACACCAGAGAAGGTGAATCTAGACCTGTTACGTGAAAAACTCAAAAGAATAC
ATTCCCAGAAACTTCAAATACCAAACCCAGAAAAACAAACAGATAAGTAAAGCATGCCATAAACACGAAC
AGTAAAGCAAGGGATGCGAGAAACTTACAGTGAAGTGTTGAAACTGGGGGTTCTGTTGTCGATCAAACAA
AGGAAATATAGGCTGACAGTGGTGAATGAAGGATAACAGGGAAATTTGTAGAGTGTTCGAAGGTTTTTTC
TTGGTCTGGGGATTTTGCTCTGAAAAACTCGAACAAAGTTGGCAAGAAATGGAAAGTAACCAAATGAAGG
AAAGATGGTGGCTTTTATAGGCCAAAGTGCATGAGGAACAGGCACCATCACCTACCAATCGAACGGCTGG
GGGGGCGCACGATTCGAATTCCCAAGAATCAACAGTTGGATTGATTCGTAATTAAGGCGGTGGAAACGCT
TGAGTATCCGTCTGACACCATTAATGCACCGTATCAATCAATGGACATGAAACGAATCGACATCTGCAAA
AAGTGAATCGCTGCATTAGAGGCGATCATTAAATGCACCTTCACGCGCTCAAAGCTCGTGCCAGGAAACT
GAGGGGTCAATCGGAGGCACTTGAACAAGCCTTGTTTTCTTTTTCAAATAAACAAGGCTTGGGGGGTAAA
TGCTGCCCCTGATTTTGCCCAATATACGTGGACCAACCGGGGAGGGACACGTGGATCAAAACGTCTTAAT
GCTTGAATTATTTGCTAAGTCTTTGTGATATAAGGCAGCATCCGAGACATGCCTCCCAGAGAAGGCATGC
TGAGCCCCATACGCTCCCGGATGCCCAAGTAATACTAAGGCATCTCCGCAGGGTGTCAAGCTTCCCCTGA
GCAGTCAATTCGCATTTAATGCCGCATGGGAGGAAACGTGTTGGGATTGCTACACGCAATAAAGTCTGAC
GGCACAACCCCCAATCTGCAGCTGCGAAGTAATGATCATTTAAGTCTATTGACGGCTACACTGTGAAGAG
TCACATCAGTCAAAAGACAATAAGGACATTCCACATAAAAGCCCTACTACACCTAGGACTTGACCATGCA
TTACTCATGGTATATTCATTGGGAATACCCATCTTTATGGATTTTACAGATACACATGTACAATAATCCT
GGGGATTACCCCACCAAAAACACTATAAATACCCCCCTCAAAGCTCATTAAATGGGGTCGAGAATTTTGG
GTTGCATAAAAGCAAGAAGAGTGAATACTCACCAAGAACATTCTCTGTATTTATAAGAGTAAATATTCAC
CAAGAACATTCTCTGTATTAAATACATCCATAAATAACACAGACTCGTGGACTAAGGCTCATTAACGCCC
CAACCACGTAAAAATCTTTCTCTAAATTTTCTTACAGTTCTCGTATCTTATAATATTTTATTGGTTGCCA
edited for brevity
Last edited:
CannaT
starin' at the world through my rearview
We need just to respect someones else work much more.
Some people put many work hours in philos and in seedfinder to.
Are they perfect ? no.
Are they worthy ?
yes
Its easiest to say you are liar or its bullshit.
The hardest part is to give something new or better.
Some people put many work hours in philos and in seedfinder to.
Are they perfect ? no.
Are they worthy ?
yes
Its easiest to say you are liar or its bullshit.
The hardest part is to give something new or better.
Tynehead Tom
Well-known member
i don't trust any data from phylos...
Granted, but I believe the phylos data an inch more than what I’ve read on seedfinder over the years. It only takes one dedicated misinformed person, with a lot of time on their hands, and the lineage of many many entries are screwed.
This thread is about Bog Sour Bubble. You already put forward your THSeeds theory. There’s nothing to be gained from continually trying to divert back to a point that many who are in the know say is almost 100% unviable. You can hold your theory close to your heart, but until you can provide better evidence that isn’t just a couple of pictures, seedfinder screenshots and your own nose, you’re not going to have many people listen to you.
No one is disrespecting the work of someone else.
acespicoli
Well-known member
The obvious thing about Phylos is the samples are grouped by terpenes ?
Hemp Landrace were the most subjective classes besides hybrids
CBD and Berry
Skunk OG Kush were obviously hybrids
What is the easiest way to view a genetic shotgun array ? How to use that data in breeding?
As far as SourBubble eyes nose heady effects should do for this preservation? (resin yield)
Integrating Genomic and Phenomic Approaches to Support Plant Genetic Resources Conservation and Use
Plant genebanks provide genetic resources for breeding and research programs worldwide. These programs benefit from having access to high-quality, standardized phenotypic and genotypic data. Technological advances have made it possible to collect phenomic and genomic data for genebank...
www.mdpi.com
Seed run **Closed**
One for 2023?
Last edited:
CannaT
starin' at the world through my rearview
Hi man.
I found some infos and they are in my story much more than yours.
Look a member here growed WL double gum.
Which is th seeds x ss seeds bubblegum.
And there are 3 phenos.
And there is obvious Sour pheno.
So you are wrong boy and thats all...nothing "American kush" here.
Just good old bubblegum.
So Bog description was right also as my theory and you are wrong.
Just sayin.
Grow some seeds of bubblegum really great genetics.
So now much more evidences are on BOG side of story...and again people who believe in cannabis genetics stories are just like that belivers.
White Label Doublegum
Greetings Peeps! Was wondering how the high was on wls doublegum? looking for something with a sweet, euphoric, relaxing/indica stone.... thanks!
www.icmag.com
Just please dont cry and make drama now.
We just talk like real man.
Nothing personal.
🫶
Last edited:
Ah man, I’m actually laughing now 
No worries CannaT, you believe whatever you want.
No worries CannaT, you believe whatever you want.
acespicoli
Well-known member
acespicoli
Well-known member
that will do fineMy SB clone a couple years ago
View attachment 18812523 View attachment 18812524 View attachment 18812525
This is the book about BOG Bonanza Of Green <link message me if link breaks
The methods BOG used to grow the sourbubble and pictures
As seen above it this is a older 2005 book copyrighted, then later released for free by request B.O.G.
Per his wishes to be shared ,,, its archived in his thread here thought that would be appropriate,
picture above will read/download from Ace cloud
Good Read
2011 High Times San Francisco Med Cup
-1st Place | Sour Bubble
2008 Los Angeles Medical Cup
-1st Place | Bogglegum | Best Indica
Attachments
Last edited:
buckaroobonsai
Active member
I’m pretty sure that Sour Bubble won in ‘08 and Bogglegum in 2011.
that will do fine
View attachment 18812535
This is the book about BOG Bonanza Of Green <link
The methods BOG used to grow the sourbubble and pictures
2011 High Times San Francisco Med Cup
-1st Place | Sour Bubble
2008 Los Angeles Medical Cup
-1st Place | Bogglegum | Best Indica
