What's new
  • ICMag with help from Landrace Warden and The Vault is running a NEW contest in November! You can check it here. Prizes are seeds & forum premium access. Come join in!

BOG Seeds Sour Bubble.

Redrum92

Well-known member
20230220_155729 - Copy.jpg

2 BOG SB. If you listen closely, you can hear them singing
 

MrKushman247

Well-known member
Fwiw Silverback (rip) told me straight up bubblegum was bred by his family circle and bikers from Oakland. Mexican they had crossed with Afghani the bikers had and they bred it in cornfields of Indiana. He gave me beans but I couldn't get them to sprout unfortunately. I had no reason not to believe him. He was a real OG.
 

acespicoli

Well-known member
This is a good thread for reference. Lots of the bubba expression in this thread

This is a shot from Grindhouse SB bx1 ix1--2008 from Cornflake
View attachment 18812083
View attachment 18812084
I think the NL/Bubba is a huge element in the structure the leaf resin has to be over whelming
A true hashplant in the details that crust on dark wide leaves, this looks like the large fan leaves have been removed perhaps you think? Got a touch of that TH DC affie look to me, wonder if the bud could be bulked without losing the frost
 

CannaT

starin' at the world through my rearview
If you could link me with the post where someone is mentioning GG x gelato that would be cool
Screenshot_20230221_101010_Chrome.jpg


It was you 🤣🤣
But anyway breeder said no Bubba kush...so only WL bubblegum probably WL bubblegum is Bubblegumclone only x NL1 it was fruities and most indica of all NL.
So that is that connection with Bubba kush ?
 

acespicoli

Well-known member
Yeah @Hammerhead is doing the proper homework for the conservation of the pheno type most desirable, he has some frosty plants in the stable already. Cant wait to see what he comes thru with.
locking down those resin traits in the bx's is the work that has to be done, bubble bags full of resin
In your screenshots and his last post good examples of the goal, those concentrates are the medicine.



1676981207082.png

Borrowed some pics for reference
1676981620879.png

1676981658478.png

Those pictures of SourBubble kief and hash 🤤 hope some others share hash shots!
 

Attachments

  • 1676981871171.png
    1676981871171.png
    759.3 KB · Views: 63
Last edited:

Kalbhairav

~~ ॐ नमः शिवाय ~~
Veteran
View attachment 18812392

It was you 🤣🤣
But anyway breeder said no Bubba kush...so only WL bubblegum probably WL bubblegum is Bubblegumclone only x NL1 it was fruities and most indica of all NL.
So that is that connection with Bubba kush ?
You’re taking his post completely out of context. He was saying YOUR description of a THSeeds “Bubblegum” (the quote marks are because it’s not pure Bubblegum in the first place) reminds him of GG4xGelato, NOT Sour Bubble! He was saying your description does NOT sound like Sour Bubble.

You need to go back and have a VERY good look at the data supplied by Beta from Phylos. You can see the link between Sour Bubble and American Kush genetics!!

End of - you have absolutely no basis for your argument whatsoever. Just because a plant ‘looks’ a little bit like another plant means absolutely nothing.

You also seem to miss the posts where everybody concerned is talking about early SB, not the later releases of SB which you continually refer to. Your plant looks nothing like early releases of Sour Bubble.
 
Last edited:

Kalbhairav

~~ ॐ नमः शिवाय ~~
Veteran
Also @CannaT please please stop referring to seedfinder. It’s well known that the information on that website in some cases is rarely correct. It is not a moderated website. It has been pointed out on more than one occasion, by people who know, that there was definitely other genetics involved with the Sour Bubble. It was practically admitted by Bog himself to a chosen few.
 

acespicoli

Well-known member
Also @CannaT please please stop referring to seedfinder. It’s well known that the information on that website in some cases is rarely correct. It is not a moderated website. It has been pointed out on more than one occasion, by people who know, that there was definitely other genetics involved with the Sour Bubble. It was practically admitted by Bog himself to a chosen few.
Phylos and Seedfinder... Very good ideas
https://en.seedfinder.eu/userarea/login.html become a member like me and make it better edit mistakes

We need a opensource public genetic testing facility and database

Also looking into resources like this https://en.wikipedia.org/wiki/Comparison_of_genealogy_software
Plant pictures and breeding charts with DNA, many hobby breeders are likely not keeping great records

Anyone using other softs or methods? Maybe with this strain here we can do better.
FOR EXAMPLE

Cannatonic strain as a reference (GenBank MNPR01)
1676989613246.png

1676989689193.png


This type of data below wont be useful to most of us

>MNPR01000001.1 Cannabis sativa cultivar Cannatonic Cannabis.v1_scf1_q, whole genome shotgun sequence
GTGACAAGAGTAACCCTAACACCAGAGAAGGTGAATCTAGACCTGTTACGTGAAAAACTCAAAAGAATAC
ATTCCCAGAAACTTCAAATACCAAACCCAGAAAAACAAACAGATAAGTAAAGCATGCCATAAACACGAAC
AGTAAAGCAAGGGATGCGAGAAACTTACAGTGAAGTGTTGAAACTGGGGGTTCTGTTGTCGATCAAACAA
AGGAAATATAGGCTGACAGTGGTGAATGAAGGATAACAGGGAAATTTGTAGAGTGTTCGAAGGTTTTTTC
TTGGTCTGGGGATTTTGCTCTGAAAAACTCGAACAAAGTTGGCAAGAAATGGAAAGTAACCAAATGAAGG
AAAGATGGTGGCTTTTATAGGCCAAAGTGCATGAGGAACAGGCACCATCACCTACCAATCGAACGGCTGG
GGGGGCGCACGATTCGAATTCCCAAGAATCAACAGTTGGATTGATTCGTAATTAAGGCGGTGGAAACGCT
TGAGTATCCGTCTGACACCATTAATGCACCGTATCAATCAATGGACATGAAACGAATCGACATCTGCAAA
AAGTGAATCGCTGCATTAGAGGCGATCATTAAATGCACCTTCACGCGCTCAAAGCTCGTGCCAGGAAACT
GAGGGGTCAATCGGAGGCACTTGAACAAGCCTTGTTTTCTTTTTCAAATAAACAAGGCTTGGGGGGTAAA
TGCTGCCCCTGATTTTGCCCAATATACGTGGACCAACCGGGGAGGGACACGTGGATCAAAACGTCTTAAT
GCTTGAATTATTTGCTAAGTCTTTGTGATATAAGGCAGCATCCGAGACATGCCTCCCAGAGAAGGCATGC
TGAGCCCCATACGCTCCCGGATGCCCAAGTAATACTAAGGCATCTCCGCAGGGTGTCAAGCTTCCCCTGA
GCAGTCAATTCGCATTTAATGCCGCATGGGAGGAAACGTGTTGGGATTGCTACACGCAATAAAGTCTGAC
GGCACAACCCCCAATCTGCAGCTGCGAAGTAATGATCATTTAAGTCTATTGACGGCTACACTGTGAAGAG
TCACATCAGTCAAAAGACAATAAGGACATTCCACATAAAAGCCCTACTACACCTAGGACTTGACCATGCA
TTACTCATGGTATATTCATTGGGAATACCCATCTTTATGGATTTTACAGATACACATGTACAATAATCCT
GGGGATTACCCCACCAAAAACACTATAAATACCCCCCTCAAAGCTCATTAAATGGGGTCGAGAATTTTGG
GTTGCATAAAAGCAAGAAGAGTGAATACTCACCAAGAACATTCTCTGTATTTATAAGAGTAAATATTCAC
CAAGAACATTCTCTGTATTAAATACATCCATAAATAACACAGACTCGTGGACTAAGGCTCATTAACGCCC
CAACCACGTAAAAATCTTTCTCTAAATTTTCTTACAGTTCTCGTATCTTATAATATTTTATTGGTTGCCA

edited for brevity
 
Last edited:

CannaT

starin' at the world through my rearview
We need just to respect someones else work much more.
Some people put many work hours in philos and in seedfinder to.
Are they perfect ? no.
Are they worthy ?
yes

Its easiest to say you are liar or its bullshit.
The hardest part is to give something new or better.
 

Kalbhairav

~~ ॐ नमः शिवाय ~~
Veteran
i don't trust any data from phylos...

Granted, but I believe the phylos data an inch more than what I’ve read on seedfinder over the years. It only takes one dedicated misinformed person, with a lot of time on their hands, and the lineage of many many entries are screwed.

We need just to respect someones else work much more.
Some people put many work hours in philos and in seedfinder to.
Are they perfect ? no.
Are they worthy ?
yes

Its easiest to say you are liar or its bullshit.
The hardest part is to give something new or better.

This thread is about Bog Sour Bubble. You already put forward your THSeeds theory. There’s nothing to be gained from continually trying to divert back to a point that many who are in the know say is almost 100% unviable. You can hold your theory close to your heart, but until you can provide better evidence that isn’t just a couple of pictures, seedfinder screenshots and your own nose, you’re not going to have many people listen to you.

No one is disrespecting the work of someone else.
 

acespicoli

Well-known member
1677002362460.png

The obvious thing about Phylos is the samples are grouped by terpenes ?
Hemp Landrace were the most subjective classes besides hybrids
CBD and Berry
Skunk OG Kush were obviously hybrids

1677002829052.png


What is the easiest way to view a genetic shotgun array ? How to use that data in breeding?
As far as SourBubble eyes nose heady effects should do for this preservation? (resin yield)
1677003576802.png

Seed run **Closed**

One for 2023?
 
Last edited:

CannaT

starin' at the world through my rearview
Granted, but I believe the phylos data an inch more than what I’ve read on seedfinder over the years. It only takes one dedicated misinformed person, with a lot of time on their hands, and the lineage of many many entries are screwed.



This thread is about Bog Sour Bubble. You already put forward your THSeeds theory. There’s nothing to be gained from continually trying to divert back to a point that many who are in the know say is almost 100% unviable. You can hold your theory close to your heart, but until you can provide better evidence that isn’t just a couple of pictures, seedfinder screenshots and your own nose, you’re not going to have many people listen to you.

No one is disrespecting the work of someone else.
Hi man.
I found some infos and they are in my story much more than yours.
Look a member here growed WL double gum.
Which is th seeds x ss seeds bubblegum.

And there are 3 phenos.
And there is obvious Sour pheno.

So you are wrong boy and thats all...nothing "American kush" here.
Just good old bubblegum.

So Bog description was right also as my theory and you are wrong.

Just sayin.
Grow some seeds of bubblegum really great genetics.

So now much more evidences are on BOG side of story...and again people who believe in cannabis genetics stories are just like that belivers.
😉👌
Screenshot_20230221_195032_Chrome.jpg

Just please dont cry and make drama now.
We just talk like real man.
Nothing personal.
🫶
 
Last edited:

acespicoli

Well-known member
Damn that DoubleGum pheno on the link is not too shabby :thinking:
1677007555477.png

Here is a doublegum cola the size of your FOREARM!!!

this is the cola that i got from the DG she went about 65 days, a beauty she is.
1677007609080.png


Bulked up bud size there is... #10
Great to collaborate now were getting many view points :huggy:

1677008251152.png

1677008005883.png
 
Last edited:

acespicoli

Well-known member
1677008553153-png.18812530

that will do fine 🤣

This is the book about BOG Bonanza Of Green <link message me if link breaks
The methods BOG used to grow the sourbubble and pictures

As seen above it this is a older 2005 book copyrighted, then later released for free by request B.O.G.
Per his wishes to be shared ,,, its archived in his thread here thought that would be appropriate,
picture above will read/download from Ace cloud
1677014795447.png

1677014912816.png

1677015034186.png

1677016978081.png

Good Read


2011 High Times San Francisco Med Cup
-1st Place | Sour Bubble
2008 Los Angeles Medical Cup
-1st Place | Bogglegum | Best Indica
 

Attachments

  • 1677011586938.png
    1677011586938.png
    299.1 KB · Views: 275
  • 1677013219367.png
    1677013219367.png
    764 KB · Views: 230
Last edited:

Latest posts

Latest posts

Top